Volume : VII, Issue : V, May - 2018
ISOLATION OF ENDOPHYTIC BACTERIA FROM THE LEAF OF Cymbopogon winterianus AND ITS CHARACTERIZATION
Mowsam Saikia, Dr. K. J. Thara Saraswathi, Meghana M. , Helen D. , Mitali Baruah
Abstract :
Cymbopogon are aromatic grasses containing essential oil as secondary metabolite. The essential oil possess high amount of anti–microbial
activity. Cymbopogon winterianus is the citronella oil–yielding species cultivated in India. It essential oil can kill up to 99.9% of the bacteria so it
was assume that no endophytic bacteria can survive in the leaf of Cymbopogon winterianus. We isolated the endophytic bacteria from the leaf of
Cymbopogon winterianus collected from the foothill of Karbi Angalong in Assam India. The endophyte bacteria were isolated by modified leaf
impression method. The bacteria were grown from the edge of the cut site of the leaf and in presence of essential oil of the leaf the bacteria shows
growth which confirms it as endophytic bacteria. Two specific types of bacteria were seen after multiple cultures. The culture were identified by 16s
ribosomal RNA using 27F (AGAGTTTGATCATGGCTCAG) as forward primer and 1492R (TACGGCTACCTTGTTACGACTT) as reverse
primer found that two species of bacillus were found which were identified by NCBI BLAST. The strain were submitted in nucleotide database of
NCBI
Keywords :
Article:
Download PDF
DOI : 10.36106/ijsr
Cite This Article:
Mowsam Saikia, Dr. K.J.Thara Saraswathi, Meghana M., Helen D., Mitali Baruah, ISOLATION OF ENDOPHYTIC BACTERIA FROM THE LEAF OF Cymbopogon winterianus AND ITS CHARACTERIZATION, INTERNATIONAL JOURNAL OF SCIENTIFIC RESEARCH : Volume-7 | Issue-5 | May-2018
Number of Downloads : 847
References :
Mowsam Saikia, Dr. K.J.Thara Saraswathi, Meghana M., Helen D., Mitali Baruah, ISOLATION OF ENDOPHYTIC BACTERIA FROM THE LEAF OF Cymbopogon winterianus AND ITS CHARACTERIZATION, INTERNATIONAL JOURNAL OF SCIENTIFIC RESEARCH : Volume-7 | Issue-5 | May-2018
Our Other Journals...
-
Indian Journal of
Applied Research Visit Website -
PARIPEX Indian Journal
of Research Visit Website -
Global Journal for
Research Analysis Visit Website